View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20327_high_25 (Length: 253)
Name: NF20327_high_25
Description: NF20327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20327_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 12 - 232
Target Start/End: Complemental strand, 43933428 - 43933208
Alignment:
| Q |
12 |
acagaggtatctataagaacatggatgttgctattaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43933428 |
acagaggtatctataagaacatggatgttgctattaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttc |
43933329 |
T |
|
| Q |
112 |
tgaggttgctttgctgtttcgtttgcgccatccaaatatcatttcagtaagttctgtttcttcaatcatttctatttatatatagtatataccaaccata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43933328 |
tgaggttgctttgctgtttcgtttgcgccatccaaatatcatttcagtaagttctgtttcttcaatcatttctatttatatatagtatataccaaccata |
43933229 |
T |
|
| Q |
212 |
attagaaattgcagctgtagt |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43933228 |
attagaaattgcagctgtagt |
43933208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 34 - 126
Target Start/End: Complemental strand, 35132985 - 35132893
Alignment:
| Q |
34 |
ggatgttgctattaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttctgaggttgctttgct |
126 |
Q |
| |
|
||||||||| ||||||||||| ||||| || ||||| ||||| || |||||| |||| |||||||| || ||||||||||| ||||||||||| |
|
|
| T |
35132985 |
ggatgttgcaattaagcttgtgagtcagcctgaagaagatgaagatttggcttcttttcttgagaagcaatttacttctgaagttgctttgct |
35132893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University