View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20327_high_29 (Length: 246)
Name: NF20327_high_29
Description: NF20327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20327_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 18993144 - 18992924
Alignment:
| Q |
18 |
gaaagaacgaaggagtgaagtggttctgacggtgaggtgatgagtggtttctatgcttcgcaacatctttgttgagttcgtgtcacttacacaaacatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| || ||||||||| |
|
|
| T |
18993144 |
gaaagaacgaaggagtgaagtggttctgacggtgaggtgatgagtggtttctatgcttcgcaacat-tttgttgagttcgt-tcactcacccaaacatgg |
18993047 |
T |
|
| Q |
118 |
gaagaagaaagagatttaacactttcactaacaacctatgctaaacccnnnnnnncatttatttatcatggagttttgactttttatcgacacgtgttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18993046 |
gaagaagaaagagatttaacactttcactaacaacctatgctaaaccctttttttcatttatttatcatggagttttgactttttatcgacacgtgttct |
18992947 |
T |
|
| Q |
218 |
gtttcattgcctttgcttctcct |
240 |
Q |
| |
|
||||||||||| ||| ||||||| |
|
|
| T |
18992946 |
gtttcattgccattgtttctcct |
18992924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University