View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20327_high_35 (Length: 213)
Name: NF20327_high_35
Description: NF20327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20327_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 47917640 - 47917456
Alignment:
| Q |
16 |
taatagggccatacaaaaatgcaattgctttcataagtatggtcatgaagcagactgcagtacaacaaactatcaatttatggccatctttggaatcttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47917640 |
taatagggccatacaaaaatgcaattgctttcataagtatggtcatgaagctgactgcagtacaacaaactatcaatttatggccatctttggaatcttt |
47917541 |
T |
 |
| Q |
116 |
gagattttactaagtcaaatccccaacttccatgaactttcatggctctctattgttgctgccatcatgtcttttggttatgctt |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47917540 |
gagattttactaagtcaaattcccaacttccatgaactttcatggctctctattgttgctgccatcatgtcttttggttatgctt |
47917456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 91 - 200
Target Start/End: Complemental strand, 47898196 - 47898087
Alignment:
| Q |
91 |
atttatggccatctttggaatctttgagattttactaagtcaaatccccaacttccatgaactttcatggctctctattgttgctgccatcatgtctttt |
190 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| ||||| || | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47898196 |
atttatggccatctttggaagctttcagattttactaagccaaattccatatttccatgaactttcatggctctctattgttgctgccatcatgtctttt |
47898097 |
T |
 |
| Q |
191 |
ggttatgctt |
200 |
Q |
| |
|
|||||||||| |
|
|
| T |
47898096 |
ggttatgctt |
47898087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 91 - 200
Target Start/End: Complemental strand, 47909364 - 47909255
Alignment:
| Q |
91 |
atttatggccatctttggaatctttgagattttactaagtcaaatccccaacttccatgaactttcatggctctctattgttgctgccatcatgtctttt |
190 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||||||| || ||||| || | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47909364 |
atttatggccatttttggaagctttcagattttactgagccaaattccagatttccatgaactttcatggctctctattgttgctgccatcatgtctttt |
47909265 |
T |
 |
| Q |
191 |
ggttatgctt |
200 |
Q |
| |
|
|||||||||| |
|
|
| T |
47909264 |
ggttatgctt |
47909255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 47902756 - 47902576
Alignment:
| Q |
20 |
agggccatacaaaaatgcaattgctttcataagtatggtcatgaagcagactgcagtacaacaaactatcaatttatggccatctttggaatctttgaga |
119 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| | || ||| || ||||||| | | | |||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
47902756 |
agggccataaaaaaatcgaattgctttcataaggaaggccatttggcggactgcaagatatccaactataaatttatggccatcttcggaattgttgaga |
47902657 |
T |
 |
| Q |
120 |
ttttactaagtcaaatccccaacttccatgaactttcatggctctctattgttgctgccatcatgtcttttggttatgctt |
200 |
Q |
| |
|
|||||||||| | ||| || | ||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
47902656 |
ttttactaagcctaattccagatttccatgaactttcatggctctctattcttgctgccgtcatgtcttttggttatgctt |
47902576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 47923894 - 47923718
Alignment:
| Q |
20 |
agggccatacaaaaatgcaattgctttcataagtatggtcatgaagcagactgcagtacaacaaactatcaatttatggccatctttggaatctttgaga |
119 |
Q |
| |
|
||||| ||| |||||| ||| |||||||||||||||||||||||||| || |||| | | | || ||||||||||||||||||||||| | |||| |
|
|
| T |
47923894 |
agggcaataaaaaaatccaactgctttcataagtatggtcatgaagcggattgcaaaatatccaattatcaatttatggccatctttggggttacagaga |
47923795 |
T |
 |
| Q |
120 |
ttttactaagtcaaatccccaacttccatgaactttcatggctctctattgttgctgccatcatgtcttttggttat |
196 |
Q |
| |
|
|||||||||| |||||||| | ||||||||||| || |||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
47923794 |
ttttactaagccaaatcccagatttccatgaactctcctggctctctattcttgctgcagtcatgtcttttggttat |
47923718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University