View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20327_low_22 (Length: 333)
Name: NF20327_low_22
Description: NF20327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20327_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 915064 - 915275
Alignment:
| Q |
13 |
agcataggtctaaaccttggtgagagtcaagagttgccttagatgatgactgatgagtgtgtagtgcgcgtttctcatccataatcaaaataggcgcagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
915064 |
agcataggtctaaaccttggtgagagtcaagagttgtcttagatgatgactggtgagtgtgtagtgcgcgtttctcatccataatcaaaataggcgcagc |
915163 |
T |
|
| Q |
113 |
cttaatggtcaactgtagnnnnnnnnnnnngaccatgttattggtgtgaagtatccaagtcaagttccacttggaccagcataatgttgctattgcctat |
212 |
Q |
| |
|
|||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
915164 |
cttaattgtcaactgtagtttttcttttttgaccatgctattggtgtgaagtatccaagtcaagttccacttggaccagcataatgttgctattgccaat |
915263 |
T |
|
| Q |
213 |
tatagttggtat |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
915264 |
tatagttggtat |
915275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 298
Target Start/End: Original strand, 915329 - 915370
Alignment:
| Q |
257 |
tttaataatcatttaatgttctgctttgtttatggtcgagag |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
915329 |
tttaataatcatttaatgttctgctttgtttatggttgagag |
915370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University