View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20327_low_27 (Length: 250)
Name: NF20327_low_27
Description: NF20327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20327_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 30956345 - 30956109
Alignment:
| Q |
7 |
agttgtgttttttgcttgataactgaggaaactaacacataccagcagtagggcccagtgatacttgggaggaatgtcaagcacactgtcacatgcgtga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30956345 |
agttgtgttttttgcttgataactgaggaaactaacacatatcagcagtaaggcccagtgatacttgggaggaatgtcaagcacactgtcacatgcgtga |
30956246 |
T |
 |
| Q |
107 |
cttataaacgccttccatgtcaacgatttcttttcccgtgtgtttcctaattttttcaaggataaaggaagaccagattctctttttgcctgaagaaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30956245 |
cttataaacgccttccatgtcaacgatttcttttcccgtgtgtttcctaattttttcaaggataaaggaagaccagattctctttttgcctgaagaaaaa |
30956146 |
T |
 |
| Q |
207 |
catgaaatatccaatcaaagtagtttcagaataatat |
243 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30956145 |
catgaaatatcgaatcaaagtagtttcagaataatat |
30956109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University