View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20327_low_31 (Length: 242)
Name: NF20327_low_31
Description: NF20327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20327_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 32604766 - 32604542
Alignment:
| Q |
1 |
cgtcgtttaatttgtcttgggaatttacnnnnnnngaaaatgttggtttcaacccatgtcaaatctcgtcacacattttgctaacatcattgtacgttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
32604766 |
cgtcgtttaatttgtcttgggaatttactttttttgaaa-tgttggtttcaacccatgtcaaatctcgtcgcacattttgctaacatcattgtgcgttcg |
32604668 |
T |
|
| Q |
101 |
accttccattttctatcgtatgtgcaatctgagccatcttgttttttactcttattgttttcaacactatgaatagaaatctaaggctccatcccaaatc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604667 |
accttccattttctatggtatgtgcaacctgagccatcttgttttttactcttattgttttcaacactatgaatagaaatctaaggctccatcccaaatc |
32604568 |
T |
|
| Q |
201 |
acatgaaagcttccaagctttctctt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32604567 |
acatgaaagcttccaagctttctctt |
32604542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University