View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20328_high_25 (Length: 241)
Name: NF20328_high_25
Description: NF20328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20328_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 78 - 225
Target Start/End: Complemental strand, 43488384 - 43488237
Alignment:
| Q |
78 |
ctactgactagtgactactcctcagagtctttagggtttgatcaagataacataaccctaaagtcataccttttgatccgagtataaggttttttaggtc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43488384 |
ctactgactagtgactactcctcagagtctttagggtttgatcaagataacataaccctaaagtcataccttttgatccgagtataaggttttttaggtc |
43488285 |
T |
|
| Q |
178 |
tctctcccaatcactatcatagtttttattgaaggatcaagttgaacc |
225 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43488284 |
tctctccctatcactatcatagtttttattgaaggatcaagttgaacc |
43488237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 43488460 - 43488410
Alignment:
| Q |
1 |
tgtattgattaattctatgttgtctagggagcatggtttgtatactcgttcc |
52 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
43488460 |
tgtattgattaattctatgttgttta-ggagcatggtttatatactcgttcc |
43488410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University