View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20328_low_22 (Length: 252)
Name: NF20328_low_22
Description: NF20328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20328_low_22 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 139 - 252
Target Start/End: Complemental strand, 32610866 - 32610754
Alignment:
| Q |
139 |
gtgctatcacttcggcgaatattcgattctcaccttccgagttgaagaatcgttcactgtttcgaatcaccaatcgatcttcaactatgcttgacggctt |
238 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32610866 |
gtgctattacttcg-cgaatattcgattctcaccttccgagttgaagaatcgttcactgattcgaatcaccgatcgatcttcaactatgcttgacggctt |
32610768 |
T |
|
| Q |
239 |
actcggtcgtggat |
252 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32610767 |
actcggtcgtggat |
32610754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 32610995 - 32610951
Alignment:
| Q |
16 |
atccaaaggtcatttcagtcattgtacaacactaatcacaaaatt |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32610995 |
atccaaaggtcatttcagtcattgtacaacactaatcacaaaatt |
32610951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University