View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20329_high_8 (Length: 242)
Name: NF20329_high_8
Description: NF20329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20329_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 12 - 166
Target Start/End: Complemental strand, 17119119 - 17118964
Alignment:
| Q |
12 |
gagatgaacaagttgcttcatcctgcacacattgtgtggcagactagagaatgt-tttagagagttctctaatggtgcgaccatgatagacttgcttaac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17119119 |
gagatgaacaagttgcttcatcctgcacacattgtgtggcagactagagaatgtatttagagagttctctaatgatgcgaccatgatagacttgcttaac |
17119020 |
T |
|
| Q |
111 |
tcattatcagtgggacatggtaggccacattctcacatcaactttaagcactttag |
166 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17119019 |
tcattatcagtgggacttagtaggccacattctcatatcaactttaagcactttag |
17118964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 164 - 220
Target Start/End: Complemental strand, 17118368 - 17118312
Alignment:
| Q |
164 |
taggatctcacgatccgtgttacaatctcacgatttacaatcttgtgaaccttccct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17118368 |
taggatctcacgatccgtgttacaatctcacgatttacaatcttgtgaaccttccct |
17118312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University