View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20329_high_8 (Length: 242)

Name: NF20329_high_8
Description: NF20329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20329_high_8
NF20329_high_8
[»] chr5 (2 HSPs)
chr5 (12-166)||(17118964-17119119)
chr5 (164-220)||(17118312-17118368)


Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 12 - 166
Target Start/End: Complemental strand, 17119119 - 17118964
Alignment:
12 gagatgaacaagttgcttcatcctgcacacattgtgtggcagactagagaatgt-tttagagagttctctaatggtgcgaccatgatagacttgcttaac 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||    
17119119 gagatgaacaagttgcttcatcctgcacacattgtgtggcagactagagaatgtatttagagagttctctaatgatgcgaccatgatagacttgcttaac 17119020  T
111 tcattatcagtgggacatggtaggccacattctcacatcaactttaagcactttag 166  Q
    |||||||||||||||| | |||||||||||||||| ||||||||||||||||||||    
17119019 tcattatcagtgggacttagtaggccacattctcatatcaactttaagcactttag 17118964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 164 - 220
Target Start/End: Complemental strand, 17118368 - 17118312
Alignment:
164 taggatctcacgatccgtgttacaatctcacgatttacaatcttgtgaaccttccct 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17118368 taggatctcacgatccgtgttacaatctcacgatttacaatcttgtgaaccttccct 17118312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University