View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2032_low_5 (Length: 285)
Name: NF2032_low_5
Description: NF2032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2032_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 28988081 - 28988356
Alignment:
| Q |
1 |
attaggtgtttcctgtatccaaaacgcaccggtgtctgacactgacacaacacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28988081 |
attaggtgtttcctgtgtccaaaacgcaccggtgtctgacactgacacaacacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtc |
28988180 |
T |
|
| Q |
101 |
ggtgtctgcttcgtagctagtaaagtctaagttagaattttggagctttaaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28988181 |
ggtgtctgcttcgtagctagtaaagtataagttagaattttggagctttaaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctc |
28988280 |
T |
|
| Q |
201 |
tgaggttgtgtacattgattatgttaatgatgcttccgggttctgattttgagccctgttattttgtggctgatgatgt |
279 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28988281 |
tgaggttgtgtac---gattatgttaatgatgcttctgggttctgattttgagccctgttattttgtggctgatgatgt |
28988356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 71 - 100
Target Start/End: Original strand, 44572654 - 44572683
Alignment:
| Q |
71 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44572654 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
44572683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University