View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20330_high_2 (Length: 354)
Name: NF20330_high_2
Description: NF20330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20330_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 28 - 333
Target Start/End: Complemental strand, 36151176 - 36150871
Alignment:
| Q |
28 |
cagaatcttctggtgcaaaaatggttaaccctccggaacctgatggcgatgataccagctgtgagttgagttgattgattaattgtgttgttttgagaag |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36151176 |
cagaatcttctggtgcaaaaatggttaacccaccggaacctgatggcgatgataccagctgcgagttgagttgattgattaattgtgttgttttgagaag |
36151077 |
T |
 |
| Q |
128 |
acggattagaacggagaaccttttggctttttgaagaatgttgattatgtcaatggtgggtccttttgggactgttatggtgggtgatggtgcaccagtt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36151076 |
acggattagaacggagaaccttttggctttttgaagaatgttgattatgtcaatggtgggtccttttgggactgttatggtgggtgatggtgcaccagct |
36150977 |
T |
 |
| Q |
228 |
ggtgttgttggaacaagtggaactgtgcttaatcctggtgatggcgctgttgctgttgttgctggtaatggtgttgatgctgttgttgatggtaagggtg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36150976 |
ggtgttgttggaacaagtggaactgtgcttaatcctggtgatggcgctgttgctgttgttgctggtaatggtgttgatgctgttgttgatggtaagggtg |
36150877 |
T |
 |
| Q |
328 |
atgatg |
333 |
Q |
| |
|
||||| |
|
|
| T |
36150876 |
gtgatg |
36150871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 28 - 327
Target Start/End: Complemental strand, 36154562 - 36154263
Alignment:
| Q |
28 |
cagaatcttctggtgcaaaaatggttaaccctccggaacctgatggcgatgataccagctgtgagttgagttgattgattaattgtgttgttttgagaag |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154562 |
cagaatcttctggtgcaaaaatggttaaccctccggaacctgatggcgatgataccagctgcgagttgagttgattgattaattgtgttgttttgagaag |
36154463 |
T |
 |
| Q |
128 |
acggattagaacggagaaccttttggctttttgaagaatgttgattatgtcaatggtgggtccttttgggactgttatggtgggtgatggtgcaccagtt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154462 |
acggattagaacggagaaccttttggctttttgaagaatgttgattatgtcaatggtgggtccttttgggactgttatggtgggtgatggtgcaccagtt |
36154363 |
T |
 |
| Q |
228 |
ggtgttgttggaacaagtggaactgtgcttaatcctggtgatggcgctgttgctgttgttgctggtaatggtgttgatgctgttgttgatggtaagggtg |
327 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36154362 |
ggtgttgttggaacaagcggaactgtacttaatcctggtgatggtgctgttgctgttgttgctggtaatggtggtgatgctgttgttgatggtaagggtg |
36154263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 87 - 159
Target Start/End: Complemental strand, 5273616 - 5273544
Alignment:
| Q |
87 |
tgtgagttgagttgattgattaattgtgttgttttgagaagacggattagaacggagaaccttttggcttttt |
159 |
Q |
| |
|
|||||||||||||| || ||||| || ||||||||||||||||| || ||||| ||||| ||||| ||||||| |
|
|
| T |
5273616 |
tgtgagttgagttggtttattaactgagttgttttgagaagacgaatgagaactgagaatctttttgcttttt |
5273544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University