View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20330_low_3 (Length: 211)
Name: NF20330_low_3
Description: NF20330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20330_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 2223233 - 2223414
Alignment:
| Q |
15 |
gattagattggtgtgaagctatgtgttcttgttttatgaaaatggatagtgaaattggagtcggtggaagttgtggtgatgaggttgatgggaataccgt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223233 |
gattggattggtgtgaagctatgtgttcttgttttatgaagatggatagtgaaattggagtcggtggaagttgtggtgatgaggttgatgggaataccgt |
2223332 |
T |
|
| Q |
115 |
gggttcgacggcggctgtggtggtggtggggaaggaggagattgtagtggcgaattgtggtgactcaagggcggtgctttgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223333 |
gggttcgacggcggctgtggtggtggtggggaaggaggagattgtagtggcgaattgtggtgactcaagggcggtgctttgt |
2223414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University