View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20332_low_2 (Length: 290)
Name: NF20332_low_2
Description: NF20332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20332_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 20 - 282
Target Start/End: Original strand, 31648476 - 31648738
Alignment:
| Q |
20 |
tcatgttccatttctgatattttgcctcattaatagcttcactctctttaaccttatctcttaacttttccaatagaagctcatattcttgtgatttctg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31648476 |
tcatgttccatttctgatattttgcctcattaatagcttcactctctttaaccttatctcttaacttttccaatagaagctcatattcttgtgatttctg |
31648575 |
T |
|
| Q |
120 |
gttcaattcacctttagcatccttagttttttcttctaactttgagcattgcacttcatannnnnnnngcatggtttctacttcttgctttaatgttgaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
31648576 |
gttcaattcacctttagcatccttagttttttcttctaactttgagcattgcacttcatattttttttgcatggtttctacttcttgcttcaatgttgaa |
31648675 |
T |
|
| Q |
220 |
atttccatacttttgtcttccacctctttagtcaatctaatgacgtctttatcgatattcttc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31648676 |
atttccatacttttgtcttccacctctttagtcaatctaatgacgtctttatcgattttcttc |
31648738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Original strand, 31648752 - 31648800
Alignment:
| Q |
233 |
tgtcttccacctctttagtcaatctaatgacgtctttatcgatattctt |
281 |
Q |
| |
|
|||||||||| ||||||||||||||||| || |||||||| || ||||| |
|
|
| T |
31648752 |
tgtcttccacttctttagtcaatctaataacttctttatcaattttctt |
31648800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 179
Target Start/End: Complemental strand, 43879354 - 43879274
Alignment:
| Q |
99 |
ctcatattcttgtgatttctggttcaattcacctttagcatccttagttttttcttctaactttgagcattgcacttcata |
179 |
Q |
| |
|
|||||||||||| || ||||| ||||||| ||||||||||| | |||| |||||| |||| |||||||| | ||||||| |
|
|
| T |
43879354 |
ctcatattcttgagacttctgtctcaattctgctttagcatccctggtttcttcttccaactgtgagcatttcgcttcata |
43879274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University