View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20332_low_3 (Length: 243)
Name: NF20332_low_3
Description: NF20332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20332_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 36125461 - 36125241
Alignment:
| Q |
14 |
gtgtcaaccttccaagccttctcatatgatcatagaactcttttttgccaactttgttcatgtgcttaaatcttttcactacaacaactggtcctgtcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36125461 |
gtgtcaaccttccaagccttctcatatgatcatagaactcttttttgccaactttgttcatgtgcttaaatcttttcactacaacaactggtcctgtcaa |
36125362 |
T |
 |
| Q |
114 |
taccatagccttgtaagtggatccaaaacttccacttcccaaaacctcagctgaggcccttaacaagtcctgcaaatcaaactcaaccctttcgttcgta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36125361 |
taccatagccttgtaagtggatccaaaacttccacttcccaaaacctctgctgaggcccttaacaagtcctgcaaatcaaactcaaccctttcgttcgta |
36125262 |
T |
 |
| Q |
214 |
acgaagttcaaatcttcatct |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36125261 |
acgaagttcaaatcttcatct |
36125241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 14 - 173
Target Start/End: Complemental strand, 1255016 - 1254857
Alignment:
| Q |
14 |
gtgtcaaccttccaagccttctcatatgatcatagaactcttttttgccaactttgttcatgtgcttaaatcttttcactacaacaactggtcctgtcaa |
113 |
Q |
| |
|
||||||| ||||||||| || |||| || ||| | ||||||| ||| ||||| || ||||||||| ||||||| || || || ||| |||||| |||| |
|
|
| T |
1255016 |
gtgtcaaacttccaagctttttcatgtgttcaaaaaactcttgtttaccaacattattcatgtgcctaaatctcttaaccaccacagttggtccattcaa |
1254917 |
T |
 |
| Q |
114 |
taccatagccttgtaagtggatccaaaacttccacttcccaaaacctcagctgaggccct |
173 |
Q |
| |
|
|| || ||||| ||||| |||||||||||||||||||| | || |||||||| ||||| |
|
|
| T |
1254916 |
aactattgccttataagttgatccaaaacttccacttccaagcacttcagctgaagccct |
1254857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University