View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20332_low_4 (Length: 223)
Name: NF20332_low_4
Description: NF20332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20332_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 31 - 204
Target Start/End: Original strand, 9813396 - 9813569
Alignment:
| Q |
31 |
gagactatagtcaagaaaaatgataagccctaccagaagaacgggaaaaaccaaaagcagcggaattataaggggtgaaacacgacctaagaaaaatgaa |
130 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9813396 |
gagaatatagtcaagaaaaatgataagccctaccagaagaacgggaaaaaccaaaagcagcagaattatatggggtgaaacacgacctaagaaaaatgaa |
9813495 |
T |
 |
| Q |
131 |
ccaaaaacaagcattgctgcaataatcaaaatgccatgatagattcatggcttggtcttgggttatatgtagag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9813496 |
ccaaaaacaagcattgctgcaataatcaaaatgccatgatagattcatggcttggtcttgggttatatgtagag |
9813569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 203
Target Start/End: Complemental strand, 49060436 - 49060402
Alignment:
| Q |
169 |
atagattcatggcttggtcttgggttatatgtaga |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49060436 |
atagattcatggcttggtcttggtttatatgtaga |
49060402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University