View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20333_low_10 (Length: 210)
Name: NF20333_low_10
Description: NF20333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20333_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 14 - 171
Target Start/End: Original strand, 34015230 - 34015385
Alignment:
| Q |
14 |
caaaggttcaaccaattagctttcgtttccgcaagactacacaagtannnnnnnnnattctttttgagagatatacccaagtattttgttcgcaaagatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34015230 |
caaaggttcaaccaattagctttcgtttccgcaagactacacaagtattttttt--attctttttgagagatatacccaagtattttgttcacaaagatt |
34015327 |
T |
|
| Q |
114 |
atgatgagagttatcattcaacacttcgatccaaatctctagtgtattgttacattat |
171 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34015328 |
atgatgagagttatcattcaagacttcgatccaaatctctagtgtattgttacattat |
34015385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University