View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20334_high_14 (Length: 250)
Name: NF20334_high_14
Description: NF20334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20334_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 41230798 - 41231036
Alignment:
| Q |
1 |
ttctttctgatgttttaaaatttcttctagtagtaatcggttgattaaatctactctaagctgctgcatctccttaaaaatctaccttgaagggagggat |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41230798 |
ttctttctaatgttttaaaatttcttctagtagtaatcggttgattgagtctactctaagctgctgcatctccttaaaaatctaccttgaagggagggat |
41230897 |
T |
 |
| Q |
101 |
gcaagaaagttatcaagcgtatgaattttgcaggaaggagctccttctggaagctttacgggttttatgttcagttttctgttagatcagcttcactcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41230898 |
gcaagaaagttatcaagcgtatgaattttgcaggaaggagctccttctggaagctttacgggttttatgttcagttttctgttagatcagcttcactcga |
41230997 |
T |
 |
| Q |
201 |
ccgaccattctccaaattggtcgcttttcctctgtctct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41230998 |
ccgaccattctccaaattggtcgcttttcctctgtctct |
41231036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 196
Target Start/End: Original strand, 6110308 - 6110339
Alignment:
| Q |
165 |
ttatgttcagttttctgttagatcagcttcac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6110308 |
ttatgttcagttttctgttagatcagcttcac |
6110339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University