View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20334_high_15 (Length: 249)
Name: NF20334_high_15
Description: NF20334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20334_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 50123283 - 50123501
Alignment:
| Q |
1 |
catttttgaatttgtctaaactttt-ttactttcaactggtagcttactccatttccattgctgcttcttggagttgaaggtagcaatgacaacattgtc |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50123283 |
catttttgaatttgtctaaactttttttactttcaactggtagcttactccatttccattgctgcttcttggagttgaaggtagcaatgacaacattgtc |
50123382 |
T |
 |
| Q |
100 |
ttgaaattcacatttccttgaaagcgtggcattggcgtctggatcgctaatgatcttcgtt-caaatgcataatttttcttcaacatttatatcttaacg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50123383 |
ttgaaattcacatttccttgaaagcgtggcgttggcgtctggatcgctaatgatcttcgttccaaatgcataatttttcttcaacatttatatcttaacg |
50123482 |
T |
 |
| Q |
199 |
tagcttcattcaaagccat |
217 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
50123483 |
tagcttcattcaaagccat |
50123501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 44 - 216
Target Start/End: Original strand, 51122758 - 51122932
Alignment:
| Q |
44 |
ttactccatttccattgctgcttcttggagttgaaggtagcaatgacaacattgtcttgaaattcacatttccttgaaagcgtggcattggcgtctggat |
143 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| | |||||||||||||||| |
|
|
| T |
51122758 |
ttactccatttttattgttgcttcttggagttgaaggtagaaacgacaacattgtcttgaagttcacatttccttgaaagaattgcattggcgtctggat |
51122857 |
T |
 |
| Q |
144 |
cgctaatgatcttcgtt-caaatgcat-aatttttcttcaacatttatatcttaacgtagcttcattcaaagcca |
216 |
Q |
| |
|
| ||||||||||| ||| |||| ||| ||||||| |||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
51122858 |
ccctaatgatctttgttccaaacacataaatttttattcaacatttatatcttaacatagcttcatccaaagcca |
51122932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University