View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20334_low_10 (Length: 314)
Name: NF20334_low_10
Description: NF20334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20334_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 308
Target Start/End: Complemental strand, 26915820 - 26915524
Alignment:
| Q |
18 |
aaaattatatttaaagagttacgatgattaataatt--------tttacgtaattatcaagatggtagactaaaaaaccaacggagattgttcttctcnn |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26915820 |
aaaattatatttaaagagttacgatgattaataattgtattggttttacgtaattatcaagatggtagactaaaaaaacaacggagattgttcttctcaa |
26915721 |
T |
 |
| Q |
110 |
nnnnnnnn-ttatcatcattactagtagttcatagactatgatatggcgtctctatgattcagattcatgattatgaattagctctttggattatgtgtt |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26915720 |
aaaaaaaaattatcatcattactagt---tcatagactatgatatggcgtccctatgattcagattcatgattatgaattagctctttggattatgtgtt |
26915624 |
T |
 |
| Q |
209 |
ttgtatattggctgtgatgcaattgcaactcattggccgcccacaactcttcccagcaagatattctaccaattcaaggtaccatgctttttcatctctc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26915623 |
ttgtatattggctgtgatgcaattgcaactcattggcggcccacaactcttcccagtaagatattctaccaattcaaggtaccatgctttttcatttctc |
26915524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University