View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20335_high_16 (Length: 384)
Name: NF20335_high_16
Description: NF20335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20335_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 214 - 295
Target Start/End: Complemental strand, 14135495 - 14135414
Alignment:
| Q |
214 |
gaattccccttcaaatcatctttttgaaacgatttgagttctgttgaattcatttttgttttgtttaaaattcaattcctca |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14135495 |
gaattccccttcaaatcatctttttgaaacgatttgagttctgttgaattcatttttgttttgtttaaaattcaattcctca |
14135414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 19 - 87
Target Start/End: Complemental strand, 14135691 - 14135623
Alignment:
| Q |
19 |
tctacatcgatgtcttcctctcatcttcttcttcctcttgttgatgccatatgtactgtattctctgtc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14135691 |
tctacatcgatgtcttcctctcatcttcttcttcctcttgttgatgccatatgtactgtattctctgtc |
14135623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 344 - 375
Target Start/End: Complemental strand, 14135365 - 14135334
Alignment:
| Q |
344 |
ataaagattcctattggtgttgtttttcttct |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14135365 |
ataaagattcctattggtgttgtttttcttct |
14135334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 214 - 294
Target Start/End: Complemental strand, 33819754 - 33819674
Alignment:
| Q |
214 |
gaattccccttcaaatcatctttttgaaacgatttgagttctgttgaattcatttttgttttgtttaaaattcaattcctc |
294 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33819754 |
gaatttcccttcaattcatctttttgaaacgatttcagttcttttgaattcatttttgttttgtataaaattcaattcctc |
33819674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University