View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20335_high_20 (Length: 333)
Name: NF20335_high_20
Description: NF20335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20335_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 66 - 221
Target Start/End: Original strand, 11465043 - 11465196
Alignment:
| Q |
66 |
gtggtgaattgagttagatcttgtaatgtgnnnnnnngaagaagagaagaagatgagggaactaactaaactactttttatgatggaaatggaaagggaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11465043 |
gtggtgaattgagttagatcttgtaatgtgtttttttgaagaagagaagaagatgagggaactaactaaactgctttttatgatggaaatggaaagggaa |
11465142 |
T |
 |
| Q |
166 |
agaaggtgatagtgaaagagaggttctttgtttctatggtatatggattatgttat |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11465143 |
agaaggtgatggtgaaagagaggttctttgtttctatgg--tatggattatgttat |
11465196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 11465236 - 11465284
Alignment:
| Q |
239 |
ctttattggtttgattaaaccactttcaacccttggatctcgcgtgcta |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11465236 |
ctttattggtttgattaaaccactttcaacccttggatctcgcatgcta |
11465284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University