View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20335_high_25 (Length: 306)
Name: NF20335_high_25
Description: NF20335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20335_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 8e-92; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 28 - 213
Target Start/End: Complemental strand, 44653102 - 44652919
Alignment:
| Q |
28 |
ttggtctgttaactaaacatactagaaaggtctttaagatgcatatgcattaatgattgtatatattgtatcaaggttctaaaaaatctacagtgaaaac |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44653102 |
ttggtctgttaactaaacatactagaaaggtctttaagatgcatatgcattaatgattgtatatattgtaacaaggttctaaaaaatctacagtgaaaac |
44653003 |
T |
|
| Q |
128 |
tgccgccacaaaaaagtatagatatattgtttttctctgttttcgcataatgaacaaaaatcacaaaaccgatgtgatgaaatgtt |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44653002 |
tgccgccacaaaaaagtatag--atattgtttttctctgttttcgcataatgaacaaaaatcacaaaaccgatgtgatgaaatgtt |
44652919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 44653159 - 44653118
Alignment:
| Q |
1 |
aaatagccactttcgttcctcttcaaattggtctgttaacta |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44653159 |
aaatagccactttcgttcctcttcaaattggtctgttaacta |
44653118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 229 - 260
Target Start/End: Complemental strand, 44652919 - 44652888
Alignment:
| Q |
229 |
tagcctaggaaacaaattgattgactcatttg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44652919 |
tagcctaggaaacaaattgattgactcatttg |
44652888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University