View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20335_high_33 (Length: 239)
Name: NF20335_high_33
Description: NF20335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20335_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 11464999 - 11464778
Alignment:
| Q |
1 |
tagaaagaaagaaagnnnnnnncattgtttatgtttatgtgatgggtggggtaacatcatcaatggcatcaaaatttgcattctttccaccaaacccacc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11464999 |
tagaaagaaagaaagaaaaaaacattgtttatgtttatgtgatgggtggggtaacatcatcaatggcatcaaaatttgcattctttccaccaaacccacc |
11464900 |
T |
 |
| Q |
101 |
atcatacaagctaatcaaagatgatttaacaggtctacttctgttaacaccatttcctcaccgtgaaaacgttgaaattatgaaactttcgacacgtcga |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||| ||||||| | ||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
11464899 |
atcatacaaactaatcaaagatgatttaacaggtcttcttctactaacaccttatcctcaccgtgaaaacgttgagattatgaaactttcgacgcgtcga |
11464800 |
T |
 |
| Q |
201 |
ggaacggagattgtggctgttt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11464799 |
ggaacggagattgtggctgttt |
11464778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 57 - 121
Target Start/End: Complemental strand, 34325519 - 34325455
Alignment:
| Q |
57 |
tcatcaatggcatcaaaatttgcattctttccaccaaacccaccatcatacaagctaatcaaaga |
121 |
Q |
| |
|
|||||||||||| | ||||| |||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
34325519 |
tcatcaatggcagcgaaattagcattctttccaccaaacccaccatcatacaaactcatcaaaga |
34325455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University