View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20335_high_8 (Length: 454)
Name: NF20335_high_8
Description: NF20335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20335_high_8 |
 |  |
|
| [»] scaffold0290 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 2e-41; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 24134140 - 24134014
Alignment:
| Q |
18 |
cttatgtggtgctttgagcacatgtgctggtatggctgctttcgtgttagggaaacaactttgtaatatcccattcatcagttattggagatttttcagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||||||||| || |||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
24134140 |
cttatgtggtgctttgagcacatgtgttcgtaaggctgctttcatgctagggaaacaactttgtaatataccacccatcagttattggagatttttcagt |
24134041 |
T |
 |
| Q |
118 |
cgaacgtttccaaaggcgaatgtaagt |
144 |
Q |
| |
|
||||||||||||| |||||||| |||| |
|
|
| T |
24134040 |
cgaacgtttccaagggcgaatgcaagt |
24134014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 24134362 - 24134314
Alignment:
| Q |
30 |
tttgagcacatgtgctggtatggctgctttcgtgttagggaaacaactt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
24134362 |
tttgagcacatgtgctggtatggctgctttggtgttaaggaaacaactt |
24134314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 34 - 78
Target Start/End: Complemental strand, 24136672 - 24136628
Alignment:
| Q |
34 |
agcacatgtgctggtatggctgctttcgtgttagggaaacaactt |
78 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
24136672 |
agcacatgtgctggtatggctgctttggtgttagggaaacgactt |
24136628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 393 - 444
Target Start/End: Complemental strand, 22829045 - 22828994
Alignment:
| Q |
393 |
aacattgagccttaatgcaagcctaatccttctattttcttccctctctctg |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22829045 |
aacattgagccttaatgcaagcctaatccttctattttcttccctctctctg |
22828994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 26 - 75
Target Start/End: Original strand, 45149223 - 45149272
Alignment:
| Q |
26 |
gtgctttgagcacatgtgctggtatggctgctttcgtgttagggaaacaa |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45149223 |
gtgctttgagcacatgtgctggtatggctgctttggtgttagggaaacaa |
45149272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 26 - 75
Target Start/End: Original strand, 45165584 - 45165633
Alignment:
| Q |
26 |
gtgctttgagcacatgtgctggtatggctgctttcgtgttagggaaacaa |
75 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| | ||| ||||||||| |
|
|
| T |
45165584 |
gtgctttgagcacatgtgctgatattgctgctttggagttggggaaacaa |
45165633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0290 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0290
Description:
Target: scaffold0290; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 207 - 246
Target Start/End: Original strand, 4256 - 4295
Alignment:
| Q |
207 |
agtgtcagaataagaacgattaagacgaagggtattttgg |
246 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
4256 |
agtgtcaaaataagaacggttaagacgaagggtattttgg |
4295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0290; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 209 - 245
Target Start/End: Original strand, 1521 - 1557
Alignment:
| Q |
209 |
tgtcagaataagaacgattaagacgaagggtattttg |
245 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1521 |
tgtcaaaagaagaacgattaagacgaagggtattttg |
1557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University