View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20335_low_28 (Length: 287)
Name: NF20335_low_28
Description: NF20335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20335_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 13 - 271
Target Start/End: Complemental strand, 16011223 - 16010965
Alignment:
| Q |
13 |
cagagatgagttttaccatttaactttggaccgactctaatcaaccaagggattgcgtttgtgggtgattttatgagaaagatattgtgtttaatgaggt |
112 |
Q |
| |
|
|||||||||||||| || ||||| ||||||||||||||||||||||||||||||| |||||| |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
16011223 |
cagagatgagttttgccgtttaattttggaccgactctaatcaaccaagggattgagtttgtaggtgatttgatgagaaacatattgtgtttaatgaggt |
16011124 |
T |
|
| Q |
113 |
agttgttttttatgtttgagaattctggaagctttaagggtaaatggttttgatggtagttagggcttgaagaagagcgccacgaggaacaaactgaatg |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16011123 |
agttgttttcgatgtttgagaattctggaagctttaagggtaaatggttttgatggtagttagggcttgaagaagagcgccacgaggaacaaactgaacg |
16011024 |
T |
|
| Q |
213 |
aaagcgaaggcgatagagttcgctgtctagtctttcggatattacttgaagaagttcct |
271 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16011023 |
aaagcgaaggcgatagagttcactgtctagtctttcggatattagttgaagaagttcct |
16010965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 138 - 220
Target Start/End: Complemental strand, 449454 - 449369
Alignment:
| Q |
138 |
tggaagctttaagggtaaatggttttgatggtagttagg---gcttgaagaagagcgccacgaggaacaaactgaatgaaagcgaa |
220 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||| | | || ||||||||||| | ||||||||| ||| ||||||||| |
|
|
| T |
449454 |
tggaaactttaagcgtaaatggttttgatggtagttaggcgggatagatgaagagcgccatgtggaacaaacagaacgaaagcgaa |
449369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University