View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20335_low_32 (Length: 256)
Name: NF20335_low_32
Description: NF20335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20335_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 13 - 238
Target Start/End: Complemental strand, 22043634 - 22043409
Alignment:
| Q |
13 |
aaaataaaattgcattatcaatttcctgataatattgatgttgtcttatcttactatggaagtagnnnnnnngcagttaaatctttcaataatctaaact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
22043634 |
aaaataaaattgcattatcaatttcctgataatgttgatgttgtcttatcttactatggaagtagtttttttgcacttaaatctttcaatactctaaact |
22043535 |
T |
 |
| Q |
113 |
ccacatcacaaatcccagattttcatagtcgaaatctagatcctgctgtatcaatttactttgacgtcactctaactcaaaatatcatggatgaaatgtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22043534 |
ccacatcacaaatcccagattttcatagtcgaaatctagatcctgctgtagcaatttcctttgacgtcactctaactcaaaatatcatggacgaaatgtc |
22043435 |
T |
 |
| Q |
213 |
tttagttacgtaattttgtttatctt |
238 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
22043434 |
tttagttacgtaatttgttttatctt |
22043409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University