View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20339_high_15 (Length: 340)
Name: NF20339_high_15
Description: NF20339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20339_high_15 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 291 - 340
Target Start/End: Complemental strand, 28180566 - 28180517
Alignment:
| Q |
291 |
ttgacccggtatctagttcaattgaattagagattttctcattgagagct |
340 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28180566 |
ttgatccggtatctagttcaattgaattagagattttctcattgagagct |
28180517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 64 - 128
Target Start/End: Complemental strand, 30130695 - 30130631
Alignment:
| Q |
64 |
aagcttaagaagatgactagtggtaacaaaattgtagaatgtgattttaaaatatccacatttac |
128 |
Q |
| |
|
||||||||||||||||||| || ||||||| || ||||||||||| | |||||| ||||||||| |
|
|
| T |
30130695 |
aagcttaagaagatgactaatgataacaaacatgaagaatgtgattgtgaaatattcacatttac |
30130631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 212 - 286
Target Start/End: Complemental strand, 30124592 - 30124520
Alignment:
| Q |
212 |
aattgaaggatatgcaaagcagaacaatattgagagtagggttggtacatgaacttcatcatcttcattttattt |
286 |
Q |
| |
|
||||||||||||||||| || ||| |||| ||||||| ||||||||||||||||| |||||| ||||||||| |
|
|
| T |
30124592 |
aattgaaggatatgcaagacataac--tattaagagtagaattggtacatgaacttcagcatctttattttattt |
30124520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 297 - 340
Target Start/End: Original strand, 21430160 - 21430203
Alignment:
| Q |
297 |
cggtatctagttcaattgaattagagattttctcattgagagct |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21430160 |
cggtatctagttcaattgacttagagattttctcattgagagct |
21430203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 298 - 338
Target Start/End: Complemental strand, 41311383 - 41311343
Alignment:
| Q |
298 |
ggtatctagttcaattgaattagagattttctcattgagag |
338 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
41311383 |
ggtatctagttcaattgacttggagattttctcattgagag |
41311343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 340
Target Start/End: Complemental strand, 43165061 - 43165019
Alignment:
| Q |
298 |
ggtatctagttcaattgaattagagattttctcattgagagct |
340 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
43165061 |
ggtatctagttcgattgacttggagattttctcattgagagct |
43165019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University