View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20339_high_21 (Length: 275)
Name: NF20339_high_21
Description: NF20339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20339_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 92 - 259
Target Start/End: Original strand, 21016045 - 21016212
Alignment:
| Q |
92 |
agagagacatacgagctgacctcaggtgcgcgtgaaacaggaaaagcgacagtaagggattgagagagagctgttggtgcatgacagaaaatgcagaaag |
191 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21016045 |
agagagatatatgagctgacctcaggtgcgcgtgaaacaggaaaagcgacggtaagggattgagagagagctgttggtgcatgacagaaaatatagaaag |
21016144 |
T |
 |
| Q |
192 |
aaagagcagctgaaaagccaaatctaaaagcactttttgcagctgattcaattttgtccactaccact |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21016145 |
aaagagcagctgaaaagccaaatctaaaagcactttttgcagctgattcaattttttccactaccact |
21016212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 21015866 - 21015952
Alignment:
| Q |
1 |
acttttctattgcgtggcttttacactttgaaaacttgttccacatacagtggaaaaaagtgttcgtggcatttcttatcataagag |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21015866 |
acttttctattgcgtggcttttacactttgaaaacttgttctacatacagtggaaaaaagtgttcgtgacatttcttatcataagag |
21015952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University