View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20339_low_26 (Length: 247)
Name: NF20339_low_26
Description: NF20339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20339_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 35354606 - 35354847
Alignment:
| Q |
1 |
tttaatgaacaaaagcacttattgtgtgtttggattcatgcaacaaaaaga--------------gtgatgcatatatacatacctgacccctgattcca |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354606 |
tttaatgaacaaaagcacttattgtgtgtttggattcatgcaacaaaaagaagcaatgaaaaagagtgatgcatatatacatacctgacccctgattcca |
35354705 |
T |
 |
| Q |
87 |
aattcgatatgaacaataccatcatcttcagtaacttcatctctttctgaagcctttctcttattacccaatataccatttgaagccataatgctcttat |
186 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354706 |
aattcgatatgaacaataccatc---ttcagtaacttcatctctttctgaagcctttctcttattacccaatataccatttgaagccataatgctcttat |
35354802 |
T |
 |
| Q |
187 |
taacctacacgtgtacacacaaacacaagaagagacggtaataag |
231 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354803 |
caacctacatgtgtacacacaaacacaagaagagacggtaataag |
35354847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University