View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20339_low_33 (Length: 202)
Name: NF20339_low_33
Description: NF20339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20339_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 54 - 185
Target Start/End: Complemental strand, 52888020 - 52887889
Alignment:
| Q |
54 |
aaagtttgaaaattctgcaattccggaatttatatgaattaagggaaaagtgagttaaaacaggaacagggcattgcaaagtggcagagagtaaagaaag |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888020 |
aaagtttgaaaattctgcaattccggaatttatatgaattaagggaaaagtgagttaaaacaggaacagggcattgcaaagtggcagagagtaaagaaag |
52887921 |
T |
 |
| Q |
154 |
gaaattggagttgcccgaggagaaaggaaagt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52887920 |
gaaattggagttgcccgaggagaaaggaaagt |
52887889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University