View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20340_high_12 (Length: 401)
Name: NF20340_high_12
Description: NF20340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20340_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 280
Target Start/End: Original strand, 33397874 - 33398136
Alignment:
| Q |
17 |
aatatactaacaaattaataacattgacaaacgaagaaggagaaccatggagtgtaacatcttgaattgatgaagagaaacttgactgattgagtctatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33397874 |
aatatactaacaaattaataacattgacaaacgaagaaggagaaccatggaatgtaacatcttgaattgatgaagagaaactagactgattgagtctatc |
33397973 |
T |
|
| Q |
117 |
acactatcaaatcatctagaggtatagttccgaacgacnnnnnnnntattcattttgacttttttggagtctgtgagttgaaactcgtgttgggggagag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
33397974 |
acactatcaaatcatctagaggtatagttccgaacgac-aaaaaaatattcattttgacttttttcgagtctgtgagttgaaacttgtgttgggggagag |
33398072 |
T |
|
| Q |
217 |
taaacgaaatctccaaatatgaaagagcaagaccttgaattgatgaagaggaacgtgctttatc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398073 |
taaacgaaatctccaaatatgaaagagcaagaccttgaattgatgaagaggaacgtgctttatc |
33398136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 280 - 374
Target Start/End: Original strand, 33398170 - 33398276
Alignment:
| Q |
280 |
caacaccaaacaaaaccctttcgctttgtttacgagtttgaaga------------ggggaggagtaaagagaaaaatagagaattctttggattttgag |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398170 |
caacaccaaacaaaaccctttcgctttgtttacgagtttgaagaggggaggtatgtggggaggagtaaagagaaaaatagagaattctttggattttgag |
33398269 |
T |
|
| Q |
368 |
aaaacgt |
374 |
Q |
| |
|
||||||| |
|
|
| T |
33398270 |
aaaacgt |
33398276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University