View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20340_high_32 (Length: 250)
Name: NF20340_high_32
Description: NF20340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20340_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 9 - 174
Target Start/End: Original strand, 8048366 - 8048531
Alignment:
| Q |
9 |
agcaaaggaactagtagttgcaaattaggtccagcctgtcggtccgtttaacctgctattttaggcaggttgggttgaggttttgtacaacaataatact |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8048366 |
agcaaacgaactagtagttgcaaattaggtccagcctgtcggtccgtttaacctgctattttaggcaggctgggttgaggttttgtacaacaataatact |
8048465 |
T |
|
| Q |
109 |
gcaaaaatatgcataaatttcaacaaaattagaatactaaaattatttatagcctcattgattatg |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8048466 |
gcaaaaatatgcataaatttcaacaaaattagaatactaaaattatttatagcctcattgattatg |
8048531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 232
Target Start/End: Original strand, 8046088 - 8046139
Alignment:
| Q |
181 |
tgatagatggatgcagttgacaatatcttgattactgaacttcatagatgga |
232 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||||| ||||||| ||||||||| |
|
|
| T |
8046088 |
tgatggatggatgcagttgacactatctggattattgaactttatagatgga |
8046139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University