View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20340_low_25 (Length: 290)
Name: NF20340_low_25
Description: NF20340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20340_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 40 - 273
Target Start/End: Original strand, 48123795 - 48124028
Alignment:
| Q |
40 |
attcacattagggctccaaaatgtcaaaccagccagatccacattgtacatagctctagcttcatttgacacaacttgtcccattgtgtaccataatgtt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48123795 |
attcacattagggctccaaaatgtcaaaccagccagatccacattgtacatagctctagcttcatttgacacaacttgtcccattgtgtaccataatgtt |
48123894 |
T |
|
| Q |
140 |
tcattaaaactagcagctgatagtatcactgctggaaagctagtagcaccgggtaccctgctatcgaaacgcgtccctggtcctacattagagacaccat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48123895 |
tcattaaaactagcagctgatagtatcactgctggaaagctagtagcaccgggtaccctgctatcgaaacgcgtccctggtcctacattagagacaccat |
48123994 |
T |
|
| Q |
240 |
gaagtgcctctgaccaccattcataagcaggaac |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
48123995 |
gaagtgcctctgaccaccattcataagcaggaac |
48124028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University