View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20340_low_29 (Length: 279)
Name: NF20340_low_29
Description: NF20340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20340_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 263
Target Start/End: Complemental strand, 46279267 - 46279020
Alignment:
| Q |
16 |
acaacaaccgcatttaattaacatgctaccgtacttgcaccccttatcatcacctcctcctttttgtgtcagtcaggctcagaataaaatgcattatgca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279267 |
acaacaaccgcatttaattaacatgctaccgtacttgcaccccttatcatcacctcctcctttttgtgtcagtcaggctcagaataaaatgcattatgca |
46279168 |
T |
 |
| Q |
116 |
ttgctgtgttatttctttgctttcctttttggaatgttatgtggtgaggtatcttcagaattttggaaacaatatttcataaatattgttgtgtgtgtat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279167 |
ttgctgtgttatttctttgctttcctttttggaatgttatgtggtgaggtatcttcagaattttggaaacaatatttcataaatattgttgtgtgtgtat |
46279068 |
T |
 |
| Q |
216 |
gtcatctctatttaaagtgttgccactttcttgtttgtttctgttctg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279067 |
gtcatctctatttaaagtgttgccactttcttgtttgtttctgttctg |
46279020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University