View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20340_low_31 (Length: 271)
Name: NF20340_low_31
Description: NF20340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20340_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 113 - 253
Target Start/End: Original strand, 33924641 - 33924780
Alignment:
| Q |
113 |
ataccaatgtatcagaaaactattaacatgtgacaattagtatttgttgattgtgaaattcatgaaataaacannnnnnnnaactttcgtttcttagagg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
33924641 |
ataccaatgtatcagaaaactattaacatgttagaattagtatttgttgattgtgaaattcatcaaataaaca-tttttttaactttcttttcttagagg |
33924739 |
T |
 |
| Q |
213 |
gctactgttaagaaatgttaattttatataggtacagtcag |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33924740 |
gctactgttaagaaatgttaattttatataggtacagtcag |
33924780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 33924585 - 33924618
Alignment:
| Q |
18 |
atagaggtgaagaatttgagagcttttctcattt |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
33924585 |
atagaggtgaagaatttgagagctgttctcattt |
33924618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University