View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20340_low_32 (Length: 259)
Name: NF20340_low_32
Description: NF20340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20340_low_32 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 68 - 259
Target Start/End: Original strand, 9334320 - 9334514
Alignment:
| Q |
68 |
actattttcaatatatcaaacatgagta---gtatactgagaattgaaacaaaatacaagtcttcttggaaatataacacttttgccagtttcaccgtca |
164 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9334320 |
actattttcaatatatcaaacatgagtagtagtatactgagaattgaaacaaaatacaagtcttcttggaaatataacaattttgccagtttcaccgtca |
9334419 |
T |
|
| Q |
165 |
tgctgtcaggatataataatacgagattaaatttccatatcgccaagttttgtgcgtaaacccaatggtgtgtctcatatcatctttctttccct |
259 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9334420 |
tgctgtcaggatataataataagagattaaatttccatatcgccaagttttgtgcgtaaacccaatggtgtgtctcatatcatctttctttccct |
9334514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 80 - 160
Target Start/End: Original strand, 9328989 - 9329068
Alignment:
| Q |
80 |
atatcaaacatgagtagtatactgagaattgaaacaaaat-acaagtcttcttggaaatataacacttttgccagtttcacc |
160 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| ||||||||| ||||||| |||| |||||||||| ||||||| |
|
|
| T |
9328989 |
atatcaaacatgagtagtat--tcagaattgaaacaaaataacaagtcttgttggaaaaataaaacttttgccaatttcacc |
9329068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University