View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20341_high_26 (Length: 239)
Name: NF20341_high_26
Description: NF20341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20341_high_26 |
 |  |
|
| [»] scaffold0542 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 5725306 - 5725507
Alignment:
| Q |
19 |
atggtgagaactaggtggtttttgccaacacaaagcacccttcaacatcatgatacacatgccgataccaaccttattatcagtagaggagaaagatgca |
118 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5725306 |
atggcgagaactaggtcgtttttgccaacacaaagcacccttcaacatcatgatacacatgccgataccaaccttattatcagtagaggaaaaagatgca |
5725405 |
T |
 |
| Q |
119 |
tcaacactacatttaaattcacttgtgcgggtcgctgtcttcgtgcgctgtgaatattgctcgatcttggtgaaacagcggtagttgttgttcttgcggt |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5725406 |
tcaacactacatttaaatccacttgtgcgggtcgctgtcttcgtgcgctgtgaatattgctcaatcttggtgaaacagcggtagttgttgttcttgcggt |
5725505 |
T |
 |
| Q |
219 |
tc |
220 |
Q |
| |
|
|| |
|
|
| T |
5725506 |
tc |
5725507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 95
Target Start/End: Original strand, 5279086 - 5279149
Alignment:
| Q |
33 |
gtggtttttgccaacacaaagcacccttcaacatcatg-atacacatgccgataccaaccttat |
95 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
5279086 |
gtggtttttcctaacacaaagcacccttcaacatcatgaatacacatgatgataccaatcttat |
5279149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 83 - 136
Target Start/End: Complemental strand, 13773259 - 13773206
Alignment:
| Q |
83 |
ataccaaccttattatcagtagaggagaaagatgcatcaacactacatttaaat |
136 |
Q |
| |
|
||||||||||||||||||| || ||||| |||||||||||| ||||||||||| |
|
|
| T |
13773259 |
ataccaaccttattatcagaggaagagaatgatgcatcaacattacatttaaat |
13773206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0542 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0542
Description:
Target: scaffold0542; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 93
Target Start/End: Original strand, 10881 - 10956
Alignment:
| Q |
19 |
atggtgagaactaggtggtttttgccaacacaaagcacccttcaacatcatg-atacacatgccgataccaacctt |
93 |
Q |
| |
|
|||| |||| |||||| |||||||| ||| |||||||||||||| ||||| | ||||||||| |||||||||||| |
|
|
| T |
10881 |
atggggagagctaggttgtttttgctaacgcaaagcacccttcagcatcacgaatacacatgttgataccaacctt |
10956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University