View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20341_high_31 (Length: 227)
Name: NF20341_high_31
Description: NF20341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20341_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 36 - 211
Target Start/End: Complemental strand, 747107 - 746940
Alignment:
| Q |
36 |
ctgggtttgaattttgatcttttaactattttaactcctttaaactttagtctgaaccaattgaattattcaatcctcaaaagaaacagggtttagctag |
135 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||| |
|
|
| T |
747107 |
ctgggtttgaattttgatctttgaactattttaactcctttaaactttagtctgaaccaattgaattattcaatcct--aaaaaaacaggctttagctag |
747010 |
T |
 |
| Q |
136 |
atgagaggtaataagtataacaatcataattgtcttgacgaagttgagagcttatcattatattaatagatagata |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
747009 |
atgagaggtgataagtataacaatcataattgtcttggcgaagttg------tatcattatattaatagatagata |
746940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University