View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20341_low_29 (Length: 230)
Name: NF20341_low_29
Description: NF20341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20341_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 36 - 191
Target Start/End: Complemental strand, 9609612 - 9609457
Alignment:
| Q |
36 |
acattgtctctggatccatttgttcttgtcttaaatagatcaggttcttgttttagtcttgtttgacctaaacatcaagcttatttgactctaagaacga |
135 |
Q |
| |
|
||||||||| |||||||| | | |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9609612 |
acattgtctttggatccactcgatcttatcttaaatagatcaagttcttgttttagtcttgtttgacctaaacatcaagcttgtttgactctaagaacga |
9609513 |
T |
 |
| Q |
136 |
gttagtctatttatcaaatatactataagaaattaataatattgaaagaaggcaca |
191 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9609512 |
gttaatctatttatcaaatatactataagaaattaataatattgaaagaagacaca |
9609457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University