View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20341_low_4 (Length: 508)
Name: NF20341_low_4
Description: NF20341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20341_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 1e-97; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 18 - 260
Target Start/End: Complemental strand, 3451252 - 3451001
Alignment:
| Q |
18 |
atcatgtacaaaa---gcaaacttcgaacttctttttcaaccgaaaagggta--------gttgcatgtgatgacaatgtgaattttgaagagcaaaaca |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3451252 |
atcatgtacaaaattagcaaacttcgaacttctttttcaaccgaaaagggtacatgtgtagttgcatgtgatgacaatgtgaattttgaagagcaaaata |
3451153 |
T |
|
| Q |
107 |
acttagtatttgcaaaccagcacttagata--acatcatagtagttatgttaggtcatatacttacataaagtaaattttagactatttatttataccct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451152 |
acttagtatttgcaaaccagcacttagatataacatcatagtagttatgttaggtcatatacttacataaagtaaattttagactatttatttataccct |
3451053 |
T |
|
| Q |
205 |
taataaccagacgggtctctatatatgcatgcatgcatgctttccctttttccttc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3451052 |
taataaccagacgggtctctatatatgcatgc----atgctttccctttttccttc |
3451001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 300 - 452
Target Start/End: Complemental strand, 3450975 - 3450825
Alignment:
| Q |
300 |
ccatcaactccgaccgccttgtactaaaataaaaccaccatcctcatcccctctttctcttctataaactatannnnnnngactctcatttctggccccc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3450975 |
ccatcaactccgaccgccttgtactaaaataaaaccaccatcctcatcccctctttctcttctataaactata-tttttcgactctcatttctggccccc |
3450877 |
T |
|
| Q |
400 |
acaagcttccattgacgaaactaagctatgcagtagaacctcccttcatcttt |
452 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3450876 |
acaagcttccattgacgaaactaagctatgcagtagaacct-ccttcatcttt |
3450825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 480 - 508
Target Start/End: Complemental strand, 3450817 - 3450789
Alignment:
| Q |
480 |
ttttggtgtaaaaatttgattcttttctt |
508 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3450817 |
ttttggtgtaaaaatttgattcttttctt |
3450789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University