View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20343_high_7 (Length: 248)
Name: NF20343_high_7
Description: NF20343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20343_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 36139777 - 36139954
Alignment:
| Q |
15 |
gaacttaatgcagtcactcgggagcgggatgatataaagaagcaatatgatgaattgagaaagaagaggtgtgcaggttatttattttgtattgttgact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36139777 |
gaacttaatgcagtcactcgggagcgggatgatataaagaagcaatatgatgaattgagaaagaagaggtgtgcaggttatttattttgtattgttgact |
36139876 |
T |
 |
| Q |
115 |
tgctttattattttctatttgtgaaaaatgtaagctgactctttcatttcagattggatgagtttatggaaggattta |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36139877 |
tgctttattattttctatttgtgaaaaatgtaagctgaatctttcatttcagattggatgagtttatggaaggattta |
36139954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 242
Target Start/End: Original strand, 30820473 - 30820699
Alignment:
| Q |
15 |
gaacttaatgcagtcactcgggagcgggatgatataaagaagcaatatgatgaattgagaaagaagaggtgtgcaggttatttattttgtattgttgact |
114 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||| |||||||||| | |||| |||||||| |||||| |
|
|
| T |
30820473 |
gaacttaatgcagtcactcaggagcgagatgatataaagaagcaacatgatgaattgagaaagaggaggtgtgcatgcaatttcttttgtatcattgact |
30820572 |
T |
 |
| Q |
115 |
tgctttattattttctatttgtgaaaaatgtaagctgactctttcatttcagattggatgagtttatggaaggatttaatgccatatcattaaagttaaa |
214 |
Q |
| |
|
||||| |||| ||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30820573 |
at-tttatgatttcctatttgtgaaaaatttaagctgaatctttaatttcagattggatgagtttatggaaggatttaatgccatatcattaaagttaaa |
30820671 |
T |
 |
| Q |
215 |
ggaatagtaccaggtttggaaatcccct |
242 |
Q |
| |
|
|||| ||||||||| |||||||||||| |
|
|
| T |
30820672 |
ggaaatgtaccaggtatggaaatcccct |
30820699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University