View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20343_low_7 (Length: 268)
Name: NF20343_low_7
Description: NF20343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20343_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 3068700 - 3068443
Alignment:
| Q |
1 |
tcaccttttccttgatgagattcacgagttcaccacttgcaaagttataagcagccttaatacattcaagataatgatgatttgagccaaaactcattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3068700 |
tcaccttttccttgatgagattcacgagttcaccacttgcaaagttataagcagccttaatacattcaagataatgatgatttgagccaaaactcattag |
3068601 |
T |
 |
| Q |
101 |
ttttgaattttctgatggagggacctagagtaacaagtaactgcgtttagtgaacagtaaatatttcacaagcatactccaagacattggtgattctttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3068600 |
ttttgaattttctgatggagggacctagagtaacaagtagctgcgtttagtgaacagtaaatatttcacaagtatactccaagacattggtgattctttt |
3068501 |
T |
 |
| Q |
201 |
actgcagataccggcaactctccatggttgctttcaccttctggtgactttgcctttg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3068500 |
actgcagataccggcaactctccatggttgctttcaccttctggtgactttgcctttg |
3068443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 3081896 - 3081715
Alignment:
| Q |
1 |
tcaccttttccttgatgagattcacgagttcaccacttgcaaagttataagcagccttaatacattcaagataatgatgatttgagccaaaactcattag |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3081896 |
tcaccttttccttaatgagattcacgagttcaccacttgcaaagttataagcagccttgatacattcaagataatgatgatttgagccaaagctcattag |
3081797 |
T |
 |
| Q |
101 |
ttttgaattttctgatggagggacctagagtaacaagtaactgcgtttagtgaacagtaaatatttcacaagcatactccaa |
182 |
Q |
| |
|
||| ||||||||||||||||| ||||||| ||| |||||||| | ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3081796 |
tttcgaattttctgatggaggcacctagaataaaaagtaactacatttagtgaacagtaaatatttcacaagcacactccaa |
3081715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 185 - 258
Target Start/End: Original strand, 3033946 - 3034019
Alignment:
| Q |
185 |
cattggtgattcttttactgcagataccggcaactctccatggttgctttcaccttctggtgactttgcctttg |
258 |
Q |
| |
|
||||||||||||||||||||| || ||| |||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3033946 |
cattggtgattcttttactgctgaaaccagcaactctacatggttactttcaccttctggtgactttgcctttg |
3034019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 185 - 258
Target Start/End: Original strand, 3041986 - 3042059
Alignment:
| Q |
185 |
cattggtgattcttttactgcagataccggcaactctccatggttgctttcaccttctggtgactttgcctttg |
258 |
Q |
| |
|
||||||||||||||||||||| || ||| |||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3041986 |
cattggtgattcttttactgctgacaccagcaactctacatggttactttcaccttctggtgactttgcctttg |
3042059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 185 - 258
Target Start/End: Complemental strand, 3064492 - 3064419
Alignment:
| Q |
185 |
cattggtgattcttttactgcagataccggcaactctccatggttgctttcaccttctggtgactttgcctttg |
258 |
Q |
| |
|
|||||||||||||||||||||| | ||| | | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3064492 |
cattggtgattcttttactgcacaaaccagtacctctccatggttgctttcaccttctggtgactttgcctttg |
3064419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 185 - 258
Target Start/End: Original strand, 3054808 - 3054881
Alignment:
| Q |
185 |
cattggtgattcttttactgcagataccggcaactctccatggttgctttcaccttctggtgactttgcctttg |
258 |
Q |
| |
|
||||||||||||||||||||| || || |||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3054808 |
cattggtgattcttttactgctgaaacaagcaactctacatggttgctttccccttctggtgactttgcctttg |
3054881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 218 - 258
Target Start/End: Complemental strand, 3072154 - 3072114
Alignment:
| Q |
218 |
ctctccatggttgctttcaccttctggtgactttgcctttg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3072154 |
ctctccatggttgctttcaccttctggtgactttgcctttg |
3072114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 185 - 256
Target Start/End: Complemental strand, 3066529 - 3066458
Alignment:
| Q |
185 |
cattggtgattcttttactgcagataccggcaactctccatggttgctttcaccttctggtgactttgcctt |
256 |
Q |
| |
|
|||||||||||||||||||||| | ||| || |||| |||||||| |||||||||||||||||||| |||| |
|
|
| T |
3066529 |
cattggtgattcttttactgcacaaaccaacacctcttcatggttgttttcaccttctggtgacttttcctt |
3066458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University