View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20345_high_19 (Length: 260)
Name: NF20345_high_19
Description: NF20345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20345_high_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 15125579 - 15125329
Alignment:
| Q |
1 |
tcgcgatcgcggtctttttaattggctatgctgctgatcttggccactccatgggcgatgatctgacgaagaaaacacggccacgtgcagtggtgatctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15125579 |
tcgcgatcgcggtctttttaattggctatgctgctgatcttggccactccatgggtgacgatctgacgaagaaaacacggccacgtgcagtggtgatctt |
15125480 |
T |
|
| Q |
101 |
tgttttcgggttttggatactagatgttgccaacaatatgcttcaaggaccttgtcgtgccttcattggtgacctcgctggtggtgatcatcgtcgaatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15125479 |
tgttttcgggttttggatactagatgtcgccaataatatgcttcaaggaccttgtcgtgccttcattggtgacctcgctggtggtgatcaccgtcgaatg |
15125380 |
T |
|
| Q |
201 |
agaattggcaatgggatgttctcttttttcatggccgtcggtaatgtcctt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15125379 |
agaattggcaatgggatgttctcttttttcatggccgtcggtaatgtcctt |
15125329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 24 - 251
Target Start/End: Original strand, 55076497 - 55076724
Alignment:
| Q |
24 |
ggctatgctgctgatcttggccactccatgggcgatgatctgacgaagaaaacacggccacgtgcagtggtgatctttgttttcgggttttggatactag |
123 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||| ||||| ||| ||||||||||||| || ||||| || || || ||| | || || |||||| |||||| |
|
|
| T |
55076497 |
ggctacgctgcagatcttggctactccatgggtgatgacctgtcgaagaaaacacgtccccgtgctgttgtcatatttatcttaggtttttgggtactag |
55076596 |
T |
|
| Q |
124 |
atgttgccaacaatatgcttcaaggaccttgtcgtgccttcattggtgacctcgctggtggtgatcatcgtcgaatgagaattggcaatgggatgttctc |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||| |||||||||| |||| |||||||| ||| |||||||||| ||||||| |||||||| |
|
|
| T |
55076597 |
atgtcgccaacaatatgcttcaaggaccctgtcgtgccttccttggtgaccttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctc |
55076696 |
T |
|
| Q |
224 |
ttttttcatggccgtcggtaatgtcctt |
251 |
Q |
| |
|
||| ||||||||||| || ||| ||||| |
|
|
| T |
55076697 |
tttcttcatggccgtgggaaatatcctt |
55076724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University