View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20345_high_24 (Length: 237)
Name: NF20345_high_24
Description: NF20345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20345_high_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 22840214 - 22840436
Alignment:
| Q |
1 |
aatttcgtagccctgcatcttaattaaacgacataccaactcaatctcatttgctaagaaaatgaaggaaagaaagtcagcatcaacattgaattgtact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22840214 |
aatttcgtagccctgcatcttaattaaacgacataccaactcaatctcatttgctaagaaaatgaaggaaagaaagtcagcatcaacattgaattgtact |
22840313 |
T |
|
| Q |
101 |
ccccatgatgacattaagccaacatgaaaggcttcaaccttcaagaaaaagataattattgattttgtccatgggaagatagacaaccaaaatgggagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22840314 |
ccccatgatgacattaagccaacatgaaaggcttcaaccttcaagaaaaagataattattgattttgtccatgggaagatagacaaccaaaatgggagat |
22840413 |
T |
|
| Q |
201 |
caaattttgtcacaaaaatattg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22840414 |
caaattttgtcacaaaaatattg |
22840436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 24630739 - 24630684
Alignment:
| Q |
7 |
gtagccctgcatcttaattaaacgacataccaactcaatctcatttgctaagaaaatgaa |
66 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
24630739 |
gtagccctgcatcttaat----cgacgtaccaactcaatcttatttgctaaaaaaatgaa |
24630684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 27919811 - 27919853
Alignment:
| Q |
180 |
tagacaaccaaaatgggagatcaaattttgtcacaaaaatatt |
222 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
27919811 |
tagacaaccaaaatgggggatcaaattttgtcacaaagatatt |
27919853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University