View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20345_high_25 (Length: 237)
Name: NF20345_high_25
Description: NF20345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20345_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 86 - 223
Target Start/End: Complemental strand, 41845798 - 41845662
Alignment:
| Q |
86 |
aatgagggttaaatttacatctgtctttggatttggtttggttgtttaaaaatcnnnnnnnnnnnnnnnattcattcaatcattttgcaacaaatagtaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41845798 |
aatgagggttaaatttacatctgtctttggatttggtttggttgtttaaaaatctttttccttttttt-attcattcaatcattttgcaacaaatagtaa |
41845700 |
T |
 |
| Q |
186 |
atgcgaatgatatgatgtgggcctgtggggcatatttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41845699 |
atgcgaatgatatgatgtgggcctgtggggcatatttg |
41845662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 41845940 - 41845864
Alignment:
| Q |
1 |
tttgataaatgactttgtttcacttgtcttgagacatagcttataatatgatctatcttgaatcagtgactctgcta |
77 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41845940 |
tttgataaatgactttgttgcacttgtcttgagacatagcttataatatgatctatcttgaatcagtgactctgcta |
41845864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University