View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20345_low_23 (Length: 253)
Name: NF20345_low_23
Description: NF20345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20345_low_23 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 238
Target Start/End: Complemental strand, 30150739 - 30150508
Alignment:
| Q |
7 |
ggagagttaaaaatgcaaatgaagtaagaaaaatgtatttaattgattaattagacctctatacgttgactaggaagccgaactaccaactaatttactt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30150739 |
ggagagttaaaaatgcaaatgaagtaagaaaaatgtatttaattgattaattagacctctatacgttgactaggaagccgaactaccaactaatttactt |
30150640 |
T |
|
| Q |
107 |
gattctaaactaacagaagccttaacacaagaggtcagaccaacaattatagctgtatatgcattgaagttatataacttataaaactagaaatttagca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30150639 |
gattctaaactaacagaagccttaacacaagaggtcagaccaacaattatagctgtatatgcattgaagttatataacttataaaactagaaatttagca |
30150540 |
T |
|
| Q |
207 |
agaacaagaatgaagaacatgtaaacaatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30150539 |
agaacaagaatgaagaacatgtaaacaatatt |
30150508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 42651 - 42696
Alignment:
| Q |
160 |
tgtatatgcattgaagttatataacttataaaactagaaatttagcaa |
207 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
42651 |
tgtatatgcattgaagttata--acttataaaactagatatttagcaa |
42696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University