View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20345_low_27 (Length: 227)
Name: NF20345_low_27
Description: NF20345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20345_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 225
Target Start/End: Complemental strand, 53307134 - 53306916
Alignment:
| Q |
7 |
gttccaacttacacataaaaatgagttaattcatatgattttttaaactcttgcctaggaccgaaagaaattatcaaatccataatacatcatagtcgtg |
106 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53307134 |
gttccaacttacacatcaaaattagttaattcatatgattttttaaactcctgcctgggaccgaaagaaattatcaaatccataatacatcatagtcatg |
53307035 |
T |
 |
| Q |
107 |
cagaatgcattaaataatgagaaccaaacatgcatcgagtcaaacaagggaaaaaatgaaatcaccacaacaaaatacaggagaattgaaaaccaaatat |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53307034 |
cagaatgcattaactaatgagaaccaaacatgcatcgagtcaaacaagggaaaaaatgaaatcaccacaacaaaatacaggagaattgaaaaccaaatat |
53306935 |
T |
 |
| Q |
207 |
gtattgaatcaagcggttc |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53306934 |
gtattgaatcaagcggttc |
53306916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University