View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20346_high_11 (Length: 293)
Name: NF20346_high_11
Description: NF20346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20346_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 263
Target Start/End: Original strand, 30032574 - 30032821
Alignment:
| Q |
16 |
attatctcacccacccttatgtaaagaaaggatggagtttagtacctgtgcaagtgatcaataagctgaagagaatgagtaaaacccacaaatcaaaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30032574 |
attatctcacccacccttatgtaaagaaaggatggagtttagtacctgtgcaagtgatcaataagctgaagagaatgagtaaaacccacaaatcaaaaag |
30032673 |
T |
|
| Q |
116 |
cagaggaagttgataaaaatggaaactttgggcagaggaagaagtaggtcttctttccatgcgacctttacgtgatctctgcattatgcacaagtcgagt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30032674 |
cagaggaagttgataaaaatggaaactttgggcagaggaagaagtaggtcttctttccatgcgacctttacgtgatctctgcattatgcacaagtcgagt |
30032773 |
T |
|
| Q |
216 |
cgcggaacatagcgcgtgatataacgttaccccgtccctcgtcttcct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30032774 |
cgcggaacatagcgcgtgatataacgttaccccgtccctcgtcttcct |
30032821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 58 - 144
Target Start/End: Complemental strand, 10546067 - 10545981
Alignment:
| Q |
58 |
tacctgtgcaagtgatcaataagctgaagagaatgagtaaaacccacaaatcaaaaagcagaggaagttgataaaaatggaaacttt |
144 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||| |||||| |||||||| |||||| || || ||||| |||||||| ||||||| |
|
|
| T |
10546067 |
tacctgtgtaactgatccataagctgaagagaataagtaaaccccacaaaacaaaaaccaaagaaagttcataaaaattaaaacttt |
10545981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University