View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20346_high_21 (Length: 203)

Name: NF20346_high_21
Description: NF20346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20346_high_21
NF20346_high_21
[»] chr7 (1 HSPs)
chr7 (16-181)||(33259847-33260012)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 181
Target Start/End: Complemental strand, 33260012 - 33259847
Alignment:
16 aagaaaaataacttggccatacggatcaaatagataaacggtgagatttctccacaaattagatatttatgaaatgaatcaagtcgccataagatgggag 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33260012 aagaaaaataacttggccatacggatcaaatagataaacggtgagatttctccacaaattagatatttatgaaatgaatcaagtcgccataagatgggag 33259913  T
116 aatgtgactgattgaacaaccaaactatctaaacagagtgagatttgttgagactaaggacgagca 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33259912 aatgtgactgattgaacaaccaaactatctaaacagagtgagatttgttgagactaaggacgagca 33259847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University