View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20346_low_15 (Length: 287)
Name: NF20346_low_15
Description: NF20346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20346_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 89 - 271
Target Start/End: Complemental strand, 41121545 - 41121363
Alignment:
| Q |
89 |
tatttttgttgttgaatgtgagagacattgtcactttaaaaatattgaaattgtaaatataatcttaaagactagcattgtacttgaaattaacattgtc |
188 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41121545 |
tatttttgttgttgaatgtgagagacgttgtcactttaaaaatattgaaattgtaaatataatcttaaagactagcattggacttgaaattaacattgtc |
41121446 |
T |
|
| Q |
189 |
taacttattcagagaataaaatgggtgtttatatacatagcagtgctgcttgtagcgacaaatagcttcccgacggaacttgg |
271 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41121445 |
tcacttattcagagaataaaatgggtgtttatatacatagcagtgctgtttgtagcgacaaatagcttcccgacggaacttgg |
41121363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 95
Target Start/End: Complemental strand, 41121646 - 41121570
Alignment:
| Q |
15 |
aatatccattaaaaataagcatatcaatgatctatactaggtattatctcactattaaaaactcatgcaatccatattttt |
95 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41121646 |
aatatccattaaaattaagcatatcaatgatctatactaggtattatctcac----aaaaactcatgcaatccatattttt |
41121570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University